<style> #title { height: 100% !important; display: flex !important; flex-direction: column !important; justify-content: center !important; } </style> <section id="title" data-background="/images/presentations/bg.svg.png" data-transition-speed="slow"> # Epigenome tools: ATAC-seq and Bisulfite-seq Nathan Sheffield <span style="font-size:0.6em"></span> <div class="bullet"> <img src="/images/external/uva_dgs_logo.svg" height="85"> <img src="/images/logo/logo_databio_long.svg" height="65"> </div> <span style="font-size:0.6em"><a href="http://www.databio.org/slides">www.databio.org/slides</a></span> </section> --- ## What is epigenomics? <div class="well"> Epigenomics is the study of the physical modifications, associations and conformations of genomic DNA sequences (Schwartzman and Tanay 2015) </div> <div class="well"> Epigenomics is the study of the chemical modification and physical conformation of cellular DNA and bound proteins </div> --- <img src="/_modules/epigenome-quick-intro/rosa2013_chromatin.png" width="550"> Rosa and Shaw 2013 --- ## The epigenome <img src="/_modules/epigenome-quick-intro/dna_folding_diversity.svg" width="700"> If we can measure how DNA is packaged, we can understand what a cell is doing --- <div style="display: flex; justify-content: space-between;"> <div style="width: 45%;"> <h3>Epigenomics</h3> the study of the chemical modification and physical conformation of cellular DNA and bound proteins </div> <div style="width: 45%;"> <h3>Epigenetics</h3> ??? </div> </div> --- ## What is epigenetics? <div class="well"> the causal study of embryological development (Waddington 1957, The strategy of the genes) </div> <div class="well"> The study of mitotically and/or meiotically heritable changes in gene function that cannot be explained by changes in DNA sequence (Riggs et al. 1996) </div> <div class="well"> a change in the state of expression of a gene that does not involve a mutation, but that is nevertheless inherited in the absence of the signal (or event) that initiated the change. (Ptashne and Gant 2002) </div> --- ## What is epigenetics? <div class="well"> the structural adaptation of chromosomal regions so as to register, signal or perpetuate altered activity states. (Bird 2007) </div> <div class="well"> Epigenetics refers to changes in gene regulation brought about through modifications to the DNA's packaging proteins or the DNA molecules themselves without changing the underlying sequence. (Lord and Cruchaga 2014, Nature Neuroscience) </div> <div class="well"> the study of the mechanisms that allow cells to translate the nearly constant genome content of a multicellular organism into multiple functional and stable cellular conditions (Schwartzman and Tanay 2015) </div> --- ## What is epigenetics? <div style="display: flex; justify-content: space-between;"> <div style="width: 45%;"> <div class="well"> The word literally means "on top of genetics," and it's the study of how individual genes can be activated or deactivated by life experiences. (<i>The Week</i>, 2013) </div> </div> <div style="width: 45%;"> <img src="/_modules/epigenome-quick-intro/week_epigenetics.png" width="500"> </div> </div> --- <div style="display: flex; justify-content: space-between;"> <div style="width: 45%;"> <h3>Epigenomics</h3> the study of the chemical modification and physical conformation of cellular DNA and bound proteins </div> <div style="width: 45%;"> <h3>Epigenetics</h3> ??? </div> </div> --- ## What does the genome encode? <div class="col2"> <img src="/slides/epigenome-tools/sword.svg" width="75"> ### Chromatin accessibility ATAC-seq </div> <div class="col2"> <img src="/slides/epigenome-tools/bolt.svg" width="75"> ### DNA methylation Bisulfite-seq </div> <br clear="all"> --- ### What is regulatory DNA? <img src="/_modules/open-chromatin/genes1flowchart.svg" width="400" style="background:white"><br clear="all"> Regulatory DNA is a decision-maker --- ### Challenges to studying regulatory DNA - Variation: age, cell-type, environment, disease - Amount: 1-2% protein coding vs 8-20%? regulatory - Target: what gene does it affect? - Function: is it a promoter, silencer, insulator, enhancer? - Rigidity: genetic code vs TF motifs --- <div class="col2">Genetic code <img src="/_modules/open-chromatin/genetic-code.jpg" width="400"> </div> <div class="col2">Transcription factor motif <img src="/_modules/open-chromatin/motif.svg" width="400"><br clear="all"> </div> We can computationally identify genes and even predict function. Regulatory DNA is more difficult. --- ### Chromatin accessibility <div class="well"> Chromatin accessibility is the degree to which nuclear macromolecules are able to physically contact chromatinized DNA... </div> <div class="well fragment"> [It] is determined by the occupancy and topological organization of nucleosomes as well as other chromatin-binding factors that occlude access to DNA. </div> <a href="https://doi.org/10.1038/s41576-018-0089-8">Klemm et al. 2019</a> --- ### How can we identify regulatory DNA? <img src="/_modules/open-chromatin/Chromatin_Structures.png" style="background:white" width="1000"><br clear="all"> https://en.wikipedia.org/wiki/Chromatin --- ### How can we identify regulatory DNA? <img src="/_modules/open-chromatin/beads-on-a-string.jpg" width="600"><br clear="all"> Alberts 2002 --- ### How can we identify regulatory DNA? - [ChIP](https://en.wikipedia.org/wiki/ChIP_sequencing): Chromatin immunoprecipitation - [DNase](https://en.wikipedia.org/wiki/DNase-Seq): classic 'gold standard' to identify open chromatin - [ATAC](https://en.wikipedia.org/wiki/ATAC-seq): Assay for transposase-accessible chromatin - [FAIRE](https://en.wikipedia.org/wiki/FAIRE-Seq): Formaldehyde-assisted isolation of regulatory elements [Trends](https://trends.google.com/trends/explore?date=all&geo=US&q=%2Fm%2F013cd5r3,%2Fm%2F0glsck6,%2Fm%2F0glnrtn) --- ### ChIP-seq <img src="/_modules/open-chromatin/park2009_fig1.png" width="650"> --- ### DNase-seq: Biology <img src="/_modules/open-chromatin/dnase.svg" width="650"> --- <span class="bullet"><img src="/_modules/open-chromatin/sword.svg" width="75" class="bullet">ATAC-seq: Experiment (Buenrostro et al. 2013)</span> <br><img src="/_modules/open-chromatin/buenrostro2013_fig1.jpg" width="600"><br clear="all"> --- <span class="bullet">Transposase Tn5 protein (Reznikoff 2008)</span> <br><img src="/_modules/open-chromatin/reznikoff2008_fig4.jpg" width="475"><br clear="all"> --- <span class="bullet">Chromatin and transcription factors (Thurman et al. 2012)</span><br> <img src="/_modules/open-chromatin/thurman2012_fig2.jpg" width="495"><br clear="all"> --- ### Chromatin accessibility biology summary - Open chromatin usually coincides with active regulatory DNA - ... but exact annotation or binding is not provided - The advantage and disadvantage of ChIP seq is in its target. It also requires antibodies and provides more diffuse signal - ATAC is pronounced 'attack' {.fragment} --- ### Basic data analysis steps - 1. Trim adapters (fastq -> fastq) - 2. Align reads (fastq -> bam) - 3. Shift reads (bam -> bam) - 4. Call peaks (bam -> bed) --- <span class="bullet"><img src="/_modules/open-chromatin/sword.svg" width="75" class="bullet">ATAC-seq: 9 base duplication (Reznikoff 2008)</span> <br><img src="/_modules/open-chromatin/reznikoff2008_fig2.jpg" width="600"><br clear="all"> --- ### Tn5 molecular biology <img src="/_modules/open-chromatin/tn5_shift.svg" width="725" style="background:white"><br clear="all"> --- ## What is DNA methylation? <img src="/_modules/dna-meth/dnameth_intro.svg" /> --- ## DNA methylation: distribution - Cytidine and Adenine can be methylated - In mammals, DNA methylation happens at CpG dinucleotides - In mammals, DNA methylation rarely happens at CHH dinucleotides (H= A/G/T) --- ## DNA methylation: evolution and development - Plants have cytidine and adenine methylation - Yeast is typically unmethylated (but some species have some) - In mice, DNMT knockouts are embryonic lethal --- ## DNA methylation: heritability - The classic "epigenetic" mark - Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand - Maintenance methyltransferases: DNMT1 - De novo methyltransferase: DNMT3(a/b) --- ## DNA methylation: hemimethylation <img src="/_modules/dna-meth/hemimethylation.svg" /> --- ## DNA methylation: imprinting - "Imprinted" regions are parent-specific, binary allele-specific methylation - Classic example: X-inactivation. DNA methylation is critical for maintenance but not establishment of the silent X. --- ## DNA methylation: signal levels - An individual cytosine is either methylated or not methylated - Continuous measures arise via averaging at multiple resolutions: strands, alleles, cells, cell-types and genomic regions --- ## DNA methylation: gene regulation Many (not all) transcription factors are methylation-sensitive <img src="/_modules/dna-meth/dnameth_intro2.svg" /> --- ## DNA methylation in cancer - Most cancers have globally decreased methylation with punctate increased methylation - azacytidine is a cytidine analog used in cancer treatment. <img src="/_modules/dna-meth/Cytidines.svg" style="background:white"/> --- ## DNA demethylation In the active case, appears to happen via hydroxymethylation <img src="/_modules/dna-meth/ivanov2014_fig.jpg" /> Ivanov et al. 2014 --- ## DNA methylation: measuring - MeDIP assays rely on methylation-sensitive antibodies - bisulfite microarrays use base-pair hybridization - bisulfite sequencing is the de facto standard --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq</span> --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq</span> <img src="/_modules/bis-seq/dnameth_bisulfite.svg" /> --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq: Alignment issues</span> ``` CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome | | | | TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted ``` How can you align this sequence? <!-- .element: class="fragment" -->Convert the reference! <!-- .element: class="fragment" --> ``` TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Converted reference | | | | TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Fully converted ``` --- ## RRBS: Reduced Representation Bisulfite Sequencing <img src="https://www.researchgate.net/profile/Saurabh_Baheti2/publication/296329330/figure/fig3/AS:342383385432067@1458641968736/RRBS-concept-and-workflow-Genomic-DNA-is-first-digested-by-MSP1-which-cuts-at-CCGG.png"> (Baheti et al. 2016) --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq data</span> <img src="/_modules/bis-seq/igv_rrbs.svg"> --- ## RRBS vs WGBS comparison <img src="/_modules/bis-seq/rrbs_vs_wgbs.svg" width="500"/> --- ## Advanced analysis concepts <br clear="all"> --- ## Sample Pooling <img src="/slides/epigenome-tools/ss_pooling.svg" /> --- ## Epigenome signals are not in isolation <img src="/slides/epigenome-tools/methyl_k27_connect.svg" /> --- <img src="/_modules/lola-intro/LOLA-logo-white.svg" width="275" style="padding-top:25px; padding-bottom:25px"> <br> ### Locus Overlap Analysis <div class="small"> <a href="http://code.databio.org/LOLA/">http://code.databio.org/LOLA/</a><br> </div> <span class="small bullet"><img src="/_modules/lola-intro/paper.svg" height="25" class="bullet">Sheffield and Bock (2016). <i>Bioinformatics</i>.</span><br/> <span class="small bullet"><img src="/_modules/lola-intro/paper.svg" height="25" class="bullet">Nagraj, Magee, and Sheffield (2018). <i>Nucleic Acids Research</i>.</span> --- <img src="/shorts/lola/LOLA-logo-white.svg" width="275" style="padding-top:25px; padding-bottom:25px"> <br> <div class="small"> <a href="http://code.databio.org/LOLA/">http://code.databio.org/LOLA/</a><br> </div> <span style="font-size: 0.8em;"><img src="/shorts/lola/paper.svg" height="25" style="vertical-align: text-bottom; margin-right: 5px;">Sheffield and Bock (2016). *Bioinformatics*.</span><br/> <span style="font-size: 0.8em;"><img src="/shorts/lola/paper.svg" height="25" style="vertical-align: text-bottom; margin-right: 5px;">Nagraj, Magee, and Sheffield (2018). *Nucleic Acids Research*.</span> ---  ---  ---  ---  ---  ---  ---  ---  ---  ---  ---  ---  --- ## LOLAweb <img src="/shorts/lola/LOLAweb-logo-white.svg" width="275" style="padding-top:25px; padding-bottom:25px"> A shiny app and server for interactive LOLA analysis. Public server: [http://lolaweb.databio.org](http://lolaweb.databio.org) GitHub: [https://github.com/databio/LOLAweb](https://github.com/databio/LOLAweb) --- ### DEMO <video controls width="800"> <source src="lw.webm" type="video/webm"> Your browser does not support the video tag. </video> --- ## Thanks for listening!