<style> #title { height: 100% !important; display: flex !important; flex-direction: column !important; justify-content: center !important; } </style> <section id="title" data-background="/images/presentations/bg.svg.png" data-transition-speed="slow"> # DNA methylation and bisulfite-seq Nathan Sheffield <div class="bullet"> <img src="/images/external/uva_dgs_logo.svg" height="85"> <img src="/images/logo/logo_databio_long.svg" height="65"> </div> <span style="font-size:0.6em"><a href="http://www.databio.org/slides">www.databio.org/slides</a></span> </section> --- ## What is DNA methylation? <img src="/_modules/dna-meth/dnameth_intro.svg" /> --- ## DNA methylation: distribution - Cytidine and Adenine can be methylated - In mammals, DNA methylation happens at CpG dinucleotides - In mammals, DNA methylation rarely happens at CHH dinucleotides (H= A/G/T) --- ## DNA methylation: evolution and development - Plants have cytidine and adenine methylation - Yeast is typically unmethylated (but some species have some) - In mice, DNMT knockouts are embryonic lethal --- ## DNA methylation: heritability - The classic "epigenetic" mark - Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand - Maintenance methyltransferases: DNMT1 - De novo methyltransferase: DNMT3(a/b) --- ## DNA methylation: hemimethylation <img src="/_modules/dna-meth/hemimethylation.svg" /> --- ## DNA methylation: imprinting - "Imprinted" regions are parent-specific, binary allele-specific methylation - Classic example: X-inactivation. DNA methylation is critical for maintenance but not establishment of the silent X. --- ## DNA methylation: signal levels - An individual cytosine is either methylated or not methylated - Continuous measures arise via averaging at multiple resolutions: strands, alleles, cells, cell-types and genomic regions --- ## DNA methylation: gene regulation Many (not all) transcription factors are methylation-sensitive <img src="/_modules/dna-meth/dnameth_intro2.svg" /> --- ## DNA methylation in cancer - Most cancers have globally decreased methylation with punctate increased methylation - azacytidine is a cytidine analog used in cancer treatment. <img src="/_modules/dna-meth/Cytidines.svg" style="background:white"/> --- ## DNA demethylation In the active case, appears to happen via hydroxymethylation <img src="/_modules/dna-meth/ivanov2014_fig.jpg" /> Ivanov et al. 2014 --- ## DNA methylation: measuring - MeDIP assays rely on methylation-sensitive antibodies - bisulfite microarrays use base-pair hybridization - bisulfite sequencing is the de facto standard --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq</span> --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq</span> <img src="/_modules/bis-seq/dnameth_bisulfite.svg" /> --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq: Alignment issues</span> ``` CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome | | | | TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted ``` How can you align this sequence? <!-- .element: class="fragment" -->Convert the reference! <!-- .element: class="fragment" --> ``` TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Converted reference | | | | TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Fully converted ``` --- ## RRBS: Reduced Representation Bisulfite Sequencing <img src="https://www.researchgate.net/profile/Saurabh_Baheti2/publication/296329330/figure/fig3/AS:342383385432067@1458641968736/RRBS-concept-and-workflow-Genomic-DNA-is-first-digested-by-MSP1-which-cuts-at-CCGG.png"> (Baheti et al. 2016) --- ## <span class="bullet"><img src="/_modules/bis-seq/icons/bolt.svg" width="50" class="bullet" style="vertical-align: middle;"> Bisulfite-seq data</span> <img src="/_modules/bis-seq/igv_rrbs.svg"> --- ## RRBS vs WGBS comparison <img src="/_modules/bis-seq/rrbs_vs_wgbs.svg" width="500"/> --- ## Concluding thoughts - The time-scale balance between regulation and memory - A covalent modification to DNA makes a clinically useful biomarker - Methylation data is fundamentally different from RNA, more similar to genetic variation, because its number is fixed in a cell