Choose your own adventure through Sheffield lab research

# Choose your own adventure through Sheffield lab research

Nathan Sheffield

<span style="font-size:0.6em"><a href="http://www.databio.org/slides">www.databio.org/slides</a></span>

</section>
---

# Mission statement

We develop and apply computational methods<br/>
to organize, analyze, and understand large epigenomic data.<br/><br/>
<img src="/_modules/mission-statement/understand.svg" width="695">
<br> <img src="/_modules/mission-statement/logo_databio.svg" width="195">
</section>
---

# Biological motivation

<div class="col2">
<br><br>
<img src="/_modules/bio-motivation-regulatory-dna/dna_folding_diversity.svg" width="400"><br/>
Cells alter phenotype by using DNA differently. <br>
</div>

<div class="col2 fragment">
<img src="/_modules/bio-motivation-regulatory-dna/differentation_gone_awry.svg" width="500"><br/>
Breakdowns lead to disease
</div>
---

# Full-stack bioinformatics

---

# Full-stack bioinformatics

---

# Full-stack bioinformatics

---

# Full-stack bioinformatics

<div class="col2">
<img src="/_modules/full-stack-bioinformatics/pyramid_algorithms.svg" width="500"><br>
</div>
<div class="col2">
Augmented Interval List
<img src="/_modules/full-stack-bioinformatics/ailist_summary.svg" width="450"><br>
</div>

---

# Full-stack bioinformatics

---

# Full-stack bioinformatics

<div class="col2">
<img src="/_modules/full-stack-bioinformatics/pyramid_analysis.svg" width="500"><br>
</div>
<div class="col2">
Analysis of DNA methylation  
in Ewing sarcoma<br/>
<img src="/_modules/full-stack-bioinformatics/analysis_ews.svg" height="450"><br>
</div>

---

# Full-stack bioinformatics

<div class="col2">
<img src="/_modules/full-stack-bioinformatics/pyramid_yellow.svg" width="500"><br>
</div>
<div class="col2">
<img src="/_modules/full-stack-bioinformatics/integration.svg" width="500"><br>
</div>
---

# Recent projects in the Sheffield lab

- Analysis methods for genomic region sets
	- [LOLA](/slides/adventure.html#/LOLA): Enrichment of genomic ranges
	- [MIRA](/slides/adventure.html#/MIRA): DNA methyation inference of regulatory activity
	- [COCOA](/slides/adventure.html#/COCOA): Covariation analysis of epigenetic heterogeneity
	- [PEPATAC](/slides/adventure.html#/PEPATAC): Serial alignments in ATAC-seq data processing
- Scientific computing and metadata management
	- [Refgenie](/slides/adventure.html#/refgenie): Standardizing reference assembly assets
	- [PEP](/slides/adventure.html#/pepkit): A management structure for sample metadata
	- [bulker](/slides/adventure.html#/bulker): Using docker containers for desktop computing

</section>

---

# Bonus (unpublished) topics

- [bedbase.org](http://bedbase.org)

</section>

---

### Locus Overlap Analysis

<div class="small">
<a href="http://code.databio.org/LOLA/">http://code.databio.org/LOLA/</a><br>
</div>
<span class="small bullet"><img src="/_modules/lola-intro/paper.svg" height="25" class="bullet">Sheffield and Bock (2016). <i>Bioinformatics</i>.</span><br/>
<span class="small bullet"><img src="/_modules/lola-intro/paper.svg" height="25" class="bullet">Nagraj, Magee, and Sheffield (2018). <i>Nucleic Acids Research</i>.</span>
---

<div class="small">
<a href="http://code.databio.org/LOLA/">http://code.databio.org/LOLA/</a><br>
</div>

<span style="font-size: 0.8em;"><img src="/shorts/lola/paper.svg" height="25" style="vertical-align: text-bottom; margin-right: 5px;">Sheffield and Bock (2016). *Bioinformatics*.</span><br/>
<span style="font-size: 0.8em;"><img src="/shorts/lola/paper.svg" height="25" style="vertical-align: text-bottom; margin-right: 5px;">Nagraj, Magee, and Sheffield (2018). *Nucleic Acids Research*.</span>

---

![New data](/shorts/lola/01-new-data.svg)

---

![New data connection](/shorts/lola/02-new-data-connection.svg)

---

![GSEA](/shorts/lola/03-gsea.svg)

---

![HTS](/shorts/lola/04-hts.svg)

---

![Convert](/shorts/lola/05-convert.svg)

---

![Introducing LOLA](/shorts/lola/06-introducing-lola.svg)

---

![LOLA 1](/shorts/lola/07-lola1.svg)

---

![LOLA 2](/shorts/lola/08-lola2.svg)

---

![Test](/shorts/lola/09-test.svg)

---

![Results](/shorts/lola/10-results.svg)

---

![EWS vs others 2](/shorts/lola/ews_vs_others2.svg)

---

![EWS vs others 3](/shorts/lola/ews_vs_others3.svg)

---

## LOLAweb

A shiny app and server for interactive LOLA analysis.

Public server: [http://lolaweb.databio.org](http://lolaweb.databio.org)

GitHub: [https://github.com/databio/LOLAweb](https://github.com/databio/LOLAweb)

---

### DEMO

<video controls width="800">
  <source src="lw.webm" type="video/webm">
Your browser does not support the video tag.
</video>
---

## Methylation-based Inference of Regulatory Activity (MIRA)

<div class="small">
<a href="http://code.databio.org/MIRA/">http://code.databio.org/MIRA/</a><br>
</div>
<span class="small bullet"><img src="/_modules/mira/icons/paper.svg" height="25" class="bullet">Lawson et al. (2018). <i>Bioinformatics</i>.</span>
---

<div class="small">
<a href="{{project_url}}">{{project_url}}</a><br>
</div>
<span class="small bullet"><img src="/_modules/project-cover/icons/paper.svg" height="25" class="bullet" style="vertical-align: text-bottom; margin-right: 5px;">{{project_citations}}</span>
---

## MIRA concept

---

## MIRA workflow

---

## MIRA analysis

---

## MIRA results: Differential activity

<span class="small bullet"><img src="/_modules/mira/icons/paper.svg" height="25" class="bullet">Sheffield et al. (2017). <i>Nature Medicine</i>.</span>

---

## MIRA results: Activity scores

---

## MIRA results: Enrichment analysis

<img src="/_modules/mira/ews_pat/MIRA_result_3.svg" width="800"/>
---

## Coordinate Covariation Analysis (COCOA)

<div class="small">
<a href="http://code.databio.org/COCOA/">http://code.databio.org/COCOA/</a><br>
</div>

<span class="small bullet"><img src="/_modules/genomicdistributions/paper.svg" height="25" class="bullet">Lawson et al. (2020). <i>Genome Biology</i>.</span>
---

# Choose your own adventure through Sheffield lab research

Nathan Sheffield

<span style="font-size:0.6em"><a href="http://www.databio.org/slides">www.databio.org/slides</a></span>

</section>
---

@title

---

@cocoa

---

## Acknowledgments

**Collaborators**
- Fran Garrett-Bakelman
- Stefan Bekiranov

</div>

**Sheffield lab**
- **John Lawson**
- **Jason Smith**
- Jianglin Feng
- Michal Stolarczyk
- Kristyna Kupkova
- Aaron Gu
- Jose Verdezoto
- Tessa Danehy

</div>

**Funding:**

UVA Cancer Center

</div>
---

## Acknowledgments

**Collaborators**
- Fran Garrett-Bakelman
- Stefan Bekiranov

</div>

**Sheffield lab**
- **John Lawson**
- **Jason Smith**
- Jianglin Feng
- Michal Stolarczyk
- Kristyna Kupkova
- Aaron Gu
- Jose Verdezoto
- Tessa Danehy

</div>

**Funding:**

UVA Cancer Center

</div>
---

<div>
<img src="/_modules/pepatac/logo_pepatac.svg" width="175" style="padding-top:25px; padding-bottom:25px">
<br>
A robust ATAC-seq pipeline <br>
built on the PEP toolkit

<div class="small">
<a href="http://code.databio.org/PEPATAC">http://code.databio.org/PEPATAC</a><br>
</div>
</div>

---

---

### Comparison

---

### Prealignments

Nuclear-mitochondrial DNA (NuMts) confuse aligners

---

---

---

---

<img src="/_modules/pepatac/numts_alignment_blacklist.svg" width="800">
<div>
<li>Inaccurate alignment statistics</li>
<li>Requires pre-defined NuMt locations</li>
<li>Wastes compute power</li>
</div>

---

---

---

### Advantages of serial alignments

- Accuracy (better rates plus no blacklist needed).
- Speed.
- Modular reference assemblies.

---

---

### Output

---

<img src="/_modules/pepatac/pepatac_summary.png" width="800"><br>
<a href="http://code.databio.org/PEPATAC/files/examples/gold/summary.html">http://code.databio.org/PEPATAC/files/examples/gold/summary.html</a>

---

A full-service reference genome manager.

<div class="small">
<a href="http://refgenie.databio.org">http://refgenie.databio.org</a><br>
</div>
<span class="small bullet"><img src="/_modules/refgenie/paper.svg" height="25" class="bullet"><a href="https://www.biorxiv.org/content/10.1093/gigascience/giz149">Stolarczyk et al. (2020).</a> <i>GigaScience</i>.</span><br/>
<span class="small bullet"><img src="/_modules/refgenie/paper.svg" height="25" class="bullet"><a href="https://doi.org/10.1093/nargab/lqab036">Stolarczyk, Xue, and Sheffield (2021).</a> <i>NAR Genomics and Bioinformatics</i>.</span><br/>

---

## The problem

Many tools require genome-related assets (like indexes).

<br>How should we organize these on disk?<br>

---

## A standard organization simplifies tool interface

Flexible paths must be passed individually:
```
pipeline.py --bowtie2-index path/to/hg38/bowtie2-index \
  --tss_annotation path/to/hg38/tss_annotation.bed \
  --ensembl_anno path/to/hg38/ensembl_v86.gtf
```

A standard establishes expectations:
```
pipeline.py --genome hg38
```

---

## Illumina's [iGenomes](https://support.illumina.com/sequencing/sequencing_software/igenome.html) is one  answer

iGenomes is *a collection of reference sequences and annotation files for commonly analyzed organisms*.

You download a tarball of a standard structure for your genome of interest, then write tools off that.

---

## The 'central repository' approach is limited
- *Not scripted.* No iGenomes for an arbitrary genome/asset.
- *Not modular*. No access to individual assets.
- *Not programmatic*. Can't access data/metadata via API.

---

## Refgenie solves these limitations

- *Two ways to retrieve an asset.*
  - `build` any asset from a recipe.
  - `pull` any individual asset from a server
- *Better discoverability and modularity*.
  - `list/listr` shows assets
  - `refgenieserver` is a browseable web interface and API
- *Managed locations*.
  - `seek` returns the local path to assets
  - `add/remove` to manage your own assets

---

## Refgenie consists of 3 components

---

## Refgenie splits tasks between CLI and server

---

## Refgenie CLI example

[http://refgenie.databio.org](http://refgenie.databio.org)

---

## The build/pull method needs provenance checks

### Asset provenance:
<img src="/_modules/refgenie/asset_provenance.svg" style="background:white" width="300">
</div>
<div class="col2">
### Genome provenance:
<img src="/_modules/refgenie/genome_provenance.svg" style="background:white" width="300">
</div>

---

<div>

### Refget

Refget enables access to reference sequences <br>
using an identifier derived from the sequence itself.

<div class="small">
<a href="http://samtools.github.io/hts-specs/refget.html">http://samtools.github.io/hts-specs/refget.html</a><br>

---

## How refget works

---

## Refgenie implements (collection) refget-like

You first have to have the `fasta` asset:
```
refgenie pull -g hg38 -a fasta
```

Then you can use `getseq`:

```
refgenie getseq -g hg38 -l chr1:50000-50400
AAACAGGTTAATCGCCACGACATAGTAGTATTTAGAGTTACTAGTAAGCCTGATGCCACTACACAATTCTAGCTTTTCTCTTTAGGATGATTGTTTCATTCAGTCTTATCTCTTTTAGAAAACATAGGAAAAAATTATTTAATAATAAAATTTAATTGGCAAAATGAAGGTATGGCTTATAAGAGTGTTTTCCTATTGTTTTCAGTGTAGGACTCACTGTTCTAAATAACTGGGACACCCAAGGATTCTGTAAAATGCCATCCAGTTATCATTTATATTCCCTAACTCAAAATTCATTCACATGTATTCATTTTTTTCTAAACAAATTAGCATGTAGAATTCTGGTTAAAATTTGGCATAGAACACCCGGGTATTTTTTCATAATGCACCCAATAACTGT
```

---

## Refget v2.0: Collections for genome provenance

---

## Recursive checksums have advantages

Allows getting content list only<br><br>

Preserves chromosome order<br><br>

Re-uses the checksum function<br><br>

Duplicates are stored only once<br><br>

Go one step further for...<br><br>

</div>
<div class="col2">
<img src="/_modules/refgenie/checksum_recursion.svg" style="background:white" width="400">
</div>

---

## It keeps going... and going...

---

### Asset provenance:
<img src="/_modules/refgenie/asset_provenance.svg" style="background:white" width="300">
<br>Recipes + containers?
</div>
<div class="col2">
### Genome provenance:
<img src="/_modules/refgenie/genome_provenance.svg" style="background:white" width="300">
<br>Solved by refget v2.0?
</div>

---

## Tying human identifiers to a digest:

```
hg38:
  refget_digest: 32a37a52a377d95bfd4b3d66763e1396a4480f34ab5c318a
```
---

# Choose your own adventure through Sheffield lab research

Nathan Sheffield

<span style="font-size:0.6em"><a href="http://www.databio.org/slides">www.databio.org/slides</a></span>

</section>
---

## PEP: Portable Encapsulated Projects

---

<div class="bullet">
  <h2><img src="/_modules/pep-format/pep_logo.svg" width="70">PEP format</h2>
</div>

Start with a simple CSV with tabular data.

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">samples.csv
</div>

```
sample_name,protocol,organism,input_file
frog_0h,RNA-seq,frog,/path/to/frog0.gz
frog_1h,RNA-seq,frog,/path/to/frog1.gz
frog_2h,RNA-seq,frog,/path/to/frog2.gz
frog_3h,RNA-seq,frog,/path/to/frog3.gz
```

---

<div class="bullet">
	<h2><img src="/_modules/pep-format/pep_logo.svg" width="70">PEP format</h2>
</div>

Add a YAML for project-level data.

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">samples.csv
</div>

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">project_config.yaml
</div>

```yaml
sample_table: /path/to/samples.csv
output_dir: /path/to/output/folder
other_variable: value
```

---

### Add programmatic sample and project modifiers.

<div style="text-align: left">
<span class="bullet"><img src="/_modules/pep-format/replace_white.svg" width="50" class="bullet">Derived attributes</span><br>
<span class="bullet"><img src="/_modules/pep-format/implies_white.svg" width="50" class="bullet">Implied attributes</span><br>
<span class="bullet"><img src="/_modules/pep-format/subproject_white.svg" width="50" class="bullet">Subprojects</span><br>
</div>

---

<span class="bullet"><img src="/_modules/pep-format/replace_white.svg" width="50" class="bullet">Derived attributes</span><br>
<div class="well">Automatically build new sample attributes from existing attributes.</div>

Without derived attribute:

| sample_name | t | protocol | organism | input_file |
|-------------|---|:--------:|----------|------------|
| frog_0h | 0 | RNA-seq | frog | /path/to/frog0.gz |
| frog_1h | 1 | RNA-seq | frog | /path/to/frog1.gz |
| frog_2h | 2 | RNA-seq | frog | /path/to/frog2.gz |
| frog_3h | 3 | RNA-seq | frog | /path/to/frog3.gz |

Using derived attribute:

| sample_name | t | protocol | organism | input_file |
|-------------|---|:--------:|----------|------------|
| frog_0h | 0 | RNA-seq | frog | my_samples |
| frog_1h | 1 | RNA-seq | frog | my_samples |
| frog_2h | 2 | RNA-seq | frog | my_samples |
| frog_3h | 3 | RNA-seq | frog | my_samples |
| crab_0h | 0 | RNA-seq | crab | your_samples |
| crab_3h | 3 | RNA-seq | crab | your_samples |

---

Project config file:

```yaml
sample_modifiers:
  derive:
    attributes: [input_file]
    sources:
      my_samples: "/path/to/my/samples/{organism}_{t}h.gz"
      your_samples: "/path/to/your/samples/{organism}_{t}h.gz"
```

{variable} identifies sample annotation columns

<div class="well">Benefit: Enables distributed files, portability</div>

---

<span class="bullet"><img src="/_modules/pep-format/implies_white.svg" width="50" class="bullet">Implied attributes</span><br>

<div class="well">Add new sample attributes conditioned on values of existing attributes</div>

<div class="col2">
Before:<br>

| sample_name | protocol | organism |
|-------------|:--------:|----------|
| human_1 | RNA-seq | human |
| human_2 | RNA-seq | human |
| human_3 | RNA-seq | human |
| mouse_1 | RNA-seq | mouse |

</div>

<div class="col2">
After:<br>

| sample_name | protocol | organism | genome |
|-------------|:--------:|----------|--------|
| human_1 | RNA-seq | human | hg38 |
| human_2 | RNA-seq | human | hg38 |
| human_3 | RNA-seq | human | hg38 |
| mouse_1 | RNA-seq | mouse | mm10 |

</div>

---

| sample_name | protocol | organism |
|-------------|:--------:|----------|
| human_1 | RNA-seq | human |
| human_2 | RNA-seq | human |
| human_3 | RNA-seq | human |
| mouse_1 | RNA-seq | mouse |

Project config file:

```yaml
sample_modifiers:
  imply:
    - if: 
        organism: human
      then:
        genome: hg38
    - if:
        organism: mouse
      then:
        genome: mm10
```

<div class="well">Benefit: Divides project from sample metadata</div>

---

<span class="bullet"><img src="/_modules/pep-format/subproject.svg" width="50" class="bullet">Subprojects</span><br>

<div class="well">Define activatable project attributes.</div>

```yaml
project_modifiers:
  amendments:
    diverse:
      metadata:
        sample_annotation: psa_rrbs_diverse.csv
    cancer:
      metadata:
        sample_annotation: psa_rrbs_intracancer.csv
```

<div class="well">Benefit: Defines multiple similar projects in a single file</div>
---

# Thank You

<span class="small bullet"><img src="/images/external/github_bug_black.svg" height="20" class="bullet"><a href="http://github.com/nsheff">nsheff</a></span> &middot;
<span class="small bullet"><img src="/images/icons/web.svg" height="25" class="bullet"><a href="http://databio.org">databio.org</a></span> &middot;
<span class="small bullet"><img src="/images/icons/letter.svg" height="25" class="bullet"><a href="mailto:nsheffield@virginia.edu">nsheffield@virginia.edu</a></span>

</section>
---

We are now in the
  
# Era of Large Biomedical Data

<span class="fragment">Hypothesis: <br><br>

# The most important advances of the future will come from studies that can integrate data from lots of sources

</span>

<div class="fragment">Integrating data introduces 2 major challenges:
<br/>

<ol>
	<li><span class="fragment">Data scale</span></li>
	<li><span class="fragment">Data harmonization</span></li>
</ol>
</div>

---

# Why is data harmonization hard?

<div class="fragment">
Because it's exponential.<br>
Each new dataset adds N additional pairwise comparisons.
<img src="/shorts/pepkit/stars.gif">
</div>

---

# The conundrum

We stand to benefit immensely <br/> from integrating broader and broader data sources.<br><br>

BUT...the wider our integration effort,<br/>  the more challenging the integration.

---

<div>
<img 
	src="/shorts/pepkit/pep_logo_white.svg" 
	width="150"
>
<h3>Pepkit</h3>

A structure and toolkit for organizing large-scale, <br>
sample-intensive biological research projects<br>

<div class="small">
<a href="http://pepkit.github.io/">http://pepkit.github.io/</a><br>
</div>
</div>
<span class="small bullet"><img src="/shorts/pepkit/paper.svg" height="25" class="bullet"><a href="http://dx.doi.org/10.1093/gigascience/giab077">Sheffield et al. (2021).</a> <i>GigaScience</i>.</span>

<br/>
<ul class="fragment">
<li>1. Metadata management</li>
<li>2. Pipeline development</li>
<li>3. Reproducible computing environments</li>
</ul>

---

<img src="/shorts/pepkit/pepkit_subway_map.png">
---

## PEP: Portable Encapsulated Projects

---

<div class="bullet">
  <h2><img src="/_modules/pep-format/pep_logo.svg" width="70">PEP format</h2>
</div>

Start with a simple CSV with tabular data.

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">samples.csv
</div>

---

<div class="bullet">
	<h2><img src="/_modules/pep-format/pep_logo.svg" width="70">PEP format</h2>
</div>

Add a YAML for project-level data.

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">samples.csv
</div>

<hr>
<div class="bullet">
<img src="/_modules/pep-format/file.svg" width="30">project_config.yaml
</div>

```yaml
sample_table: /path/to/samples.csv
output_dir: /path/to/output/folder
other_variable: value
```

---

### Add programmatic sample and project modifiers.

---

Without derived attribute:

Using derived attribute:

---

Project config file:

{variable} identifies sample annotation columns

<div class="well">Benefit: Enables distributed files, portability</div>

---

<span class="bullet"><img src="/_modules/pep-format/implies_white.svg" width="50" class="bullet">Implied attributes</span><br>

<div class="well">Add new sample attributes conditioned on values of existing attributes</div>

<div class="col2">
Before:<br>

| sample_name | protocol | organism |
|-------------|:--------:|----------|
| human_1 | RNA-seq | human |
| human_2 | RNA-seq | human |
| human_3 | RNA-seq | human |
| mouse_1 | RNA-seq | mouse |

</div>

<div class="col2">
After:<br>

</div>

---

| sample_name | protocol | organism |
|-------------|:--------:|----------|
| human_1 | RNA-seq | human |
| human_2 | RNA-seq | human |
| human_3 | RNA-seq | human |
| mouse_1 | RNA-seq | mouse |

Project config file:

```yaml
sample_modifiers:
  imply:
    - if: 
        organism: human
      then:
        genome: hg38
    - if:
        organism: mouse
      then:
        genome: mm10
```

<div class="well">Benefit: Divides project from sample metadata</div>

---

<span class="bullet"><img src="/_modules/pep-format/subproject.svg" width="50" class="bullet">Subprojects</span><br>

<div class="well">Define activatable project attributes.</div>

<div class="well">Benefit: Defines multiple similar projects in a single file</div>
---

## <img src="/_modules/bulker/bulker_logo.svg" width="250" style="vertical-align: middle;">

A multi-container environment manager.

<span class="small bullet"><img src="/_modules/bulker/icons/paper.svg" height="25" class="bullet"> Sheffield (2019). <i>OSF Preprints</i>.</span>

<div class="small">
<a href="https://bulker.io">https://bulker.io</a>
</div>

---

## Reproducibility

data + code
<span class="fragment">+ environment</span>

---

## Containers

A promising solution, but how should we use them?

<div style="display: flex; justify-content: space-between;">
<div style="width: 45%; text-align: center;">
Combined

<img src="/_modules/bulker/monolithic_containers.svg" style="padding:15px; background:white; width:300px">
</div>
<div style="width: 45%; text-align: center;">
Individual

---

## Trade-offs

|  | Combined | Individual | Bulker |
|---|:---:|:---:|:---:|
| easy to deploy | ✓ | ✗ | ✓ |
| easy to use | ✓ | ✗ | ✓ |
| reusable | ✗ | ✓ | ✓ |
| combinable | ✗ | ✓ | ✓ |
| subsetable | ✗ | ✓ | ✓ |
| space efficient | ✗ | ✓ | ✓ |

---

## How bulker does it

Two conceptual advances:

<div style="display: flex; justify-content: space-between;">
<div style="width: 45%; text-align: center;">
Containerized executables

<img src="/_modules/bulker/bulker_executables.svg" style="padding:10px; background:white; width:350px">
</div>
<div style="width: 45%; text-align: center;">
Distribute containers in sets

<img src="/_modules/bulker/modular_containers_to_crate.svg" style="padding:10px; background:white; width:325px">
</div>
</div>
---

## Thank You

<b>Collaborators</b>
<br>Vince Reuter
<br>Andre Rendeiro
<br>Levi Waldron

<br><br>
<b>Alumni</b>
<br>Aaron Gu
<br>Jianglin Feng
<br>Ognen Duzlevski
<br>Tessa Danehy
</div>

<b>Sheffield lab</b>
<br>Erfaneh Gharavi
<br>Michal Stolarczyk
<br>John Lawson
<br>Jason Smith
<br>Kristyna Kupkova
<br>John Stubbs
<br>Bingjie Xue
<br>Jose Verdezoto
<br>Nathan LeRoy
<br>Oleksandr Khoroshevskyi
</div>

<div class="col3" style="font-size:.6em">
<b>Funding:</b><br>
<br><img src="/shorts/adventure/logo/University_of_Virginia_Rotunda_logo.svg" height="40"><img src="/shorts/adventure/logo/University_of_Virginia_logo_white.svg" height="40">
<br><img src="/shorts/adventure/logo/NIH_logo_black.svg" height="80"><br>NIGMS R35-GM128636
</div>

<br clear="all"/>
<span class="small bullet"><a href="http://github.com/nsheff">nsheff</a></span> &middot;
<span class="small bullet"><a href="http://databio.org">databio.org</a></span> &middot;
<span class="small bullet"><a href="mailto:nsheffield@virginia.edu">nsheffield@virginia.edu</a></span><br>

</section>